View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_561 (Length: 204)
Name: NF11386A_low_561
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_561 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 7723171 - 7723366
Alignment:
| Q |
1 |
aagaatgatgcatcgttcatctcaagggcaacacgtgatgggacactgttcatgtggtatgtttcatggacaaaacaactcattctcaatgttattctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723171 |
aagaatgatgcatcgttcatctcaagggcaacacgtgatgggacactgttcatgtggtatgtttcatggacaaaacaactcattctcaatgttattctcc |
7723270 |
T |
|
| Q |
101 |
tcctctacaccttatgatcatgaacctgaaacatattgcttcactccgaattcttcatcttcttctgttgattgtactctttcacttggaacacca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723271 |
tcctctacaccttatgatcatgaacctgaaacatattgcttcactcctaattcttcatcttcttctgttgattgtactctttcacttggaacacca |
7723366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University