View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_564 (Length: 203)
Name: NF11386A_low_564
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_564 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 183
Target Start/End: Complemental strand, 41065846 - 41065686
Alignment:
| Q |
23 |
cagatatcagattgtaaggctttagtttttcttggacttgcagttactggaatttctggtgagattccagcaagcataggggagcttcaaaatctcaaga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41065846 |
cagatatcagattgtaaggctttagtttttcttggacttgcagttactggaatttctggtgagattccagcaagcataggggagcttcaaaatctcaaga |
41065747 |
T |
|
| Q |
123 |
cactttcagtctacacagctcatctcacaggtcaaattccactggagattcaaaactgttc |
183 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41065746 |
cgctttcagtctacacagctcatctcacaggtcaaattccactggagattcaaaactgttc |
41065686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University