View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_565 (Length: 203)
Name: NF11386A_low_565
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_565 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 4338208 - 4338410
Alignment:
| Q |
1 |
gcctgctaagaggattgtttgtgctgcttttagtggtgttctggctgttacttttgcggttgttaggatgtatcttggttgggcttatgttgggaatcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338208 |
gcctgctaagaggattgtttgtgctgcttctagtggtgttctggctgttacttttgcggttgttaggatgtatcttggttgggcttatgttgggaatcgt |
4338307 |
T |
|
| Q |
101 |
ttgctcagtgctactgttgaatgtaatgtgtattttctctctactttttaatcttatgtctaagattataatttataatcatggaaataaacaaaaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338308 |
ttgctcagtgctactgttgaatgtaatgtgtattttctctctactttttaatcttatgtctaagattataatttataatcatggaaataaacaaaaatga |
4338407 |
T |
|
| Q |
201 |
aag |
203 |
Q |
| |
|
||| |
|
|
| T |
4338408 |
aag |
4338410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University