View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_71 (Length: 392)
Name: NF11386A_low_71
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 108 - 250
Target Start/End: Complemental strand, 2501935 - 2501793
Alignment:
| Q |
108 |
agaatgaaggaagaaggtttcagctgaacaagctttcctttaaagaataaatcctctgaaggtgacagtgaaagatttgcatcacttctttcattgtttg |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501935 |
agaatgaaggaagaagatttcagctgaacaagctttcctttaaagaataaatcctctgaaggtgacagtgaaagatttgcatcacttctttcattgtttg |
2501836 |
T |
 |
| Q |
208 |
aaggagaaagtgttatcttaaactcactctcagtctcaccact |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501835 |
aaggagaaagtgttatcttaaactcactctcagtctcaccact |
2501793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 2502034 - 2501988
Alignment:
| Q |
12 |
atgaagacacgaaacttggttgctgattttaacaatgaagcagtaaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2502034 |
atgaagacacgaaacttggttgctgattttaacaatgaagcagtaaa |
2501988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University