View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_93 (Length: 367)
Name: NF11386A_low_93
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 6 - 334
Target Start/End: Original strand, 26414777 - 26415105
Alignment:
| Q |
6 |
caatgttgaagtcatcttacttatcttgattccccgagatctaactttatcatcgaaaatggcataaggccaatgcttgatcccatgtcgcataagtact |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414777 |
caatgttgaagtcatcttacttatcttgattccccgagatctaactttatcatcgaaaatggcataaggccaatgcttgatcccatgtcgcataagtact |
26414876 |
T |
|
| Q |
106 |
tattcaccttaaatttcccaatattgcagagagagtatacctgccatgatccctaagctttgttggaagtttctttcagtggattgcactgcattcttaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414877 |
tattcaccttaaatttcccaatattgcagagagagtatacctgccatgatccctaagctttgttggaagtttctttcagtggattgcactgcattcttaa |
26414976 |
T |
|
| Q |
206 |
gttaatgccacattttcatccttcaatatttaccctttcttcttctttatttatttcatgacatgttgacttgcaactttgtgaacatttcaataaattt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414977 |
gttaatgccacattttcatccttcaatatttaccctttcttcttctttatttatttcatgacatgttgacttgcaactttgtgaacatttcaataaattt |
26415076 |
T |
|
| Q |
306 |
tctaaatttcccatcttcgttttctttcc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26415077 |
tctaaatttcccatcttcgttttctttcc |
26415105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University