View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_30 (Length: 339)
Name: NF11386_high_30
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 1573174 - 1573477
Alignment:
| Q |
1 |
aaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtgggaatgtgtggacttttacccggtttcaataaacgggtcaaatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1573174 |
aaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtgggaatgtgtggatttttacccggtttctataaacgggtcaaatggt |
1573273 |
T |
 |
| Q |
101 |
ttggacacatcagtaaatggaccacatgttaagcatgtgttaaaggctagtttggatgatacaagagtggatagttatgcaattgggacttattttattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573274 |
ttggacacatcagtaaatggaccacatgttaagcatgtgttaaaggctagtttggatgatacaagagtggatagttatgcaattgggacttattttattg |
1573373 |
T |
 |
| Q |
201 |
aaaatgatacatggattcctgataacccacttgaggacgtgggtattgggttgcttttggactatggaatatactatgcttcaaagactttctatgatca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573374 |
aaaatgatacatggattcctgataacccacttgaggatgtgggtattgggttgcttttggactatggaatatactatgcttcaaagactttctatgatca |
1573473 |
T |
 |
| Q |
301 |
agtg |
304 |
Q |
| |
|
|||| |
|
|
| T |
1573474 |
agtg |
1573477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University