View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_43 (Length: 262)
Name: NF11386_high_43
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_43 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 29548414 - 29548658
Alignment:
| Q |
20 |
atcagattgggagggatccagctcccatgcagtcaacattgctcgcattcactcaatcggaacattggtggacattcaatcaagattaagctgtctatat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29548414 |
atcagattgggagggatccagctcccatgcagtcaacattgctcgcattcactcaatcggaacattgttggacattcaatcaagattaagctgtctatat |
29548513 |
T |
 |
| Q |
120 |
tcaaactcagtattttgattattaaactaaaatttaaatgtgca--nnnnnnnnnaccccaaatgcgtgaatgtgggttcccctgactattgagaatcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548514 |
tcaaactcagtattttgattattaaactaaaatttaaatgtgcatttttttttttaccccaaatgcgtgaatgtgggttcccctgactattgagaatcca |
29548613 |
T |
 |
| Q |
218 |
aattcctgattggggacatatgtacaacaacaaccaagcattatc |
262 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
29548614 |
aattcctgattgggaacatatgtacaacaacaaccaaacattatc |
29548658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University