View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11386_high_44 (Length: 256)

Name: NF11386_high_44
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11386_high_44
NF11386_high_44
[»] chr7 (2 HSPs)
chr7 (85-194)||(42307645-42307754)
chr7 (1-33)||(42307807-42307839)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 85 - 194
Target Start/End: Complemental strand, 42307754 - 42307645
Alignment:
85 ggtcttcatgattctcacttttgttttgcaatttccatgtgttgggcagtgttggcaataatcattcgaattgccgtaatactattattccttttgttga 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42307754 ggtcttcatgattctcacttttgttttgcaatttccatgtgttgggcagtgttggcaataatcattcgaattgccgtaatactattattccttttgttga 42307655  T
185 aaaaacgcgg 194  Q
    ||||||||||    
42307654 aaaaacgcgg 42307645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42307839 - 42307807
Alignment:
1 ttaaaaaccctcttctcttcccatcaattgctc 33  Q
    |||||||||||||||||||||||||||||||||    
42307839 ttaaaaaccctcttctcttcccatcaattgctc 42307807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University