View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_45 (Length: 254)
Name: NF11386_high_45
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_45 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 45785456 - 45785695
Alignment:
| Q |
15 |
atgaaggaagcacgaaccaggccttgtccggattttcttgtggaccacaaaaaggacggtctgtggcgagcttacgagcagatctgcaatccaaatggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45785456 |
atgaaggaagcacgaaccaggccttgtccggattttcttgtggaccacaaaaaggacggtctgtggcgagcttacgagcagatctgcaatccaaatggtt |
45785555 |
T |
|
| Q |
115 |
tataggtttttgccaaattgcaatatcatctttctcgataagcttattccagcaaagacttttagcaactttttcaattttagtctgctcttgattcaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45785556 |
tataggtttttgccaaattgcaatatcatctttctcgataagcttattccagcaaagacttttagcaactttttcaattttagtctgctcttgattcaag |
45785655 |
T |
|
| Q |
215 |
tcctttttggttctttgccaccctctatggtgtttattcc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45785656 |
tcctttttggttctttgccaccctctatggtgtttattcc |
45785695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 99 - 230
Target Start/End: Original strand, 65556 - 65687
Alignment:
| Q |
99 |
tgcaatccaaatggtttataggtttttgccaaattgcaatatcatctttctcgataagcttattccagcaaagacttttagcaactttttcaattttagt |
198 |
Q |
| |
|
||||||| ||||| ||| | ||||| |||||||||||||||||| ||||||| | | |||||||| ||||| |||||||| || || |||||||| || |
|
|
| T |
65556 |
tgcaatctaaatgattttttggtttctgccaaattgcaatatcacctttctccactattttattccaacaaaggcttttagctacattctcaattttggt |
65655 |
T |
|
| Q |
199 |
ctgctcttgattcaagtcctttttggttcttt |
230 |
Q |
| |
|
||||||| ||||||||| | ||| ||||||| |
|
|
| T |
65656 |
ttgctcttcattcaagtcttcttttgttcttt |
65687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University