View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_49 (Length: 244)
Name: NF11386_high_49
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 24135054 - 24134841
Alignment:
| Q |
17 |
agttttccacttctccaaagagaggaggaatcacttcccaaggcttattagtaattagttcaaaaattcaaatatttttctactatctccaacatggttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
24135054 |
agttttccacttctccaaagagagga---atcacttcccaaggcttaatagtaattagttcaaaaattcagatatttttctactatctctaacatggttc |
24134958 |
T |
|
| Q |
117 |
gcttggtacgtggtttctccagaattccttgcgaatttttgacgaactatttcttaacagtaccgcgaatcggttcacggttctcaggccacccatgcga |
216 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
24134957 |
gcttggtacgtggtttctcgagaattccttgcgaatttttgacgaactatttcataacagta-cgcgaaccggttcgcggttctcaggccacccatgcga |
24134859 |
T |
|
| Q |
217 |
attatgtatctctgctac |
234 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
24134858 |
attatgtatctatgctac |
24134841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University