View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_52 (Length: 241)
Name: NF11386_high_52
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_52 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 29548084 - 29548306
Alignment:
| Q |
19 |
ggattgaagaacggcttggagatctctgtatactaaaattcagactaaagaagtggtggatagagctaaagtacttgaagctaaactagatggcattttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548084 |
ggattgaagaacggcttggagatctccgtatactaaaattcagactaaagaagtggtggatagagctaaagtacttgaagctaaactagatggcattttg |
29548183 |
T |
 |
| Q |
119 |
aatgatcttagatatactacacacattgtaatcaatcaattctaaatttcttatttctctcattttatcatttctgaacagatcatgaagaaggttaatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29548184 |
aatgatcttagatatactacacacattgtaatcaatcaattctaaatttcttatttctctcattttatcatttctgaacagatcatgaaaaaggttaatg |
29548283 |
T |
 |
| Q |
219 |
gagtcagcgtgcaaaagcacctt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29548284 |
gagtcagcgtgcaaaagcacctt |
29548306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University