View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_55 (Length: 240)
Name: NF11386_high_55
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_55 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 36676378 - 36676158
Alignment:
| Q |
17 |
actacttacataacatcacttacaatattatatgtttagattaacgatgagtttcgtagaatcacggtgtgtcactttgattttaaactcatcgtgatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676378 |
actacttacataacatcacttacaatat---atgtttagattaacgatgagtttcgtagaatcacggtgtgtcactttgattttaaactcatcgtgatta |
36676282 |
T |
|
| Q |
117 |
taacatgcagttacatgttcttggtcgaactttagattaccagagctcccttcttctagaaactagagggctaagacnnnnnnnnnnnnctgagtgtgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36676281 |
taacatgcagttacatgttcttggtcgaactttagattaccagagctcccttcttctagaaactagagggctaagacaaaaacaaaaaactgagtgtgtt |
36676182 |
T |
|
| Q |
217 |
tgtttatttgttgttggtgaatgc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36676181 |
tgtttatttgttgttggtgaatgc |
36676158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University