View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_60 (Length: 238)
Name: NF11386_high_60
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33502606 - 33502390
Alignment:
| Q |
1 |
attgcaaattcagtttcatatttctatattcatcatcttccacatttttgcttnnnnnnnnnnnttcatcttccacattcatcatcacatcactctgtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33502606 |
attgcaaattcagtttcatatttctatattcatcatcttccacatttttccttcaaaa------ttcatcttccacattcatcatcacatcactctgtac |
33502513 |
T |
 |
| Q |
101 |
agtccttttccatggcttcttcttcaatccgtccatcactctcttcactcaacaaattaccctctttctcttcacgcaacctctctcagagattctctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33502512 |
agtccttttccatggcttcttcttcaattcgtccatcactctcttcactcaacaaattaccctctttctcttcacgcaacctctctcagagattctctct |
33502413 |
T |
 |
| Q |
201 |
ttttcatcttcgtaatggtaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33502412 |
ttttcatcttcgtaatggtaagt |
33502390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University