View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_62 (Length: 237)
Name: NF11386_high_62
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42969221 - 42968999
Alignment:
| Q |
1 |
cataagaaggaattggcataagctatcagttctaactgtcacaatgcttattttgctcatagggatttattcaattggatgttgtgctttcagaaatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42969221 |
cataagaaggaattggcataagctatcagttctaactgtcacaatgcttattttgctcatagggatttattcaattggatgttgtgcttttagaaatgca |
42969122 |
T |
 |
| Q |
101 |
agaagagctgaaacagattatccatatggtgaaaatcggatgaccaaagttagacccagatgggattaccattggtaagtccaatatatgtgatgaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42969121 |
agaagagctgaaacagattatccatatggtgaaaatcggatgaccaaagttagacccagatgggattaccattggtaagtccaatatatgtgatcaaaag |
42969022 |
T |
 |
| Q |
201 |
ttatatatgcatgcctataaatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42969021 |
ttatatatgcatgcctataaatt |
42968999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 59 - 180
Target Start/End: Complemental strand, 10678324 - 10678203
Alignment:
| Q |
59 |
atagggatttattcaattggatgttgtgctttcagaaatgcaagaagagctgaaacagattatccatatggtgaaaatcggatgaccaaagttagaccca |
158 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |||| ||||||||||| | |
|
|
| T |
10678324 |
ataggaatatattctattggatgttgtgctttcagaaatgcaagaagatctgaaactgattatccacatggtgaaaatcgtatgaggaaagttagaccta |
10678225 |
T |
 |
| Q |
159 |
gatgggattaccattggtaagt |
180 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
10678224 |
gatgggattactattggtaagt |
10678203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University