View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_63 (Length: 236)
Name: NF11386_high_63
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 36970885 - 36971084
Alignment:
| Q |
18 |
cacagagcccaacagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcg |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36970885 |
cacagagcccaacagatatcgtccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaattctgtcg |
36970984 |
T |
 |
| Q |
118 |
cacattcttgcatcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgtttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970985 |
cacattcttgcatcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctacccacattcgctatgggcaacgtttt |
36971084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 39786313 - 39786381
Alignment:
| Q |
23 |
agcccaacagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacc |
91 |
Q |
| |
|
||||||||| | |||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39786313 |
agcccaacaaacatcatcaccattcactgtcttgcgcttctccttgtgacacttgtcagatgcttcacc |
39786381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 131
Target Start/End: Complemental strand, 56068049 - 56067978
Alignment:
| Q |
60 |
ttctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgcatc |
131 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| | ||| ||||||||||||| |||| ||||||||| |
|
|
| T |
56068049 |
ttctctttctgacacttttcagatgcttcacctgttatgaagcttatgaactctgatacacactcttgcatc |
56067978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University