View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_high_66 (Length: 227)
Name: NF11386_high_66
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_high_66 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 36675731 - 36675957
Alignment:
| Q |
1 |
acacaaaccttaacactgagagagtaaagaacaatttcaccagtagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675731 |
acacaaaccttaacactgagagagtaaagaacaatttcaccaatagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaa |
36675830 |
T |
 |
| Q |
101 |
ttttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgcaagattgaatctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675831 |
ttttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgcaagattgaatctc |
36675930 |
T |
 |
| Q |
201 |
accaactttttcaccaatagtagctac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36675931 |
accaactttttcaccaatagtagctac |
36675957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 185
Target Start/End: Complemental strand, 46922450 - 46922272
Alignment:
| Q |
7 |
accttaacactgagagagtaaagaacaatttcaccagtagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaattttca |
106 |
Q |
| |
|
|||||||| |||||||| || | |||| |||| ||| ||||| ||||| | |||||||||||||||| || ||||||| ||| || || |||| |
|
|
| T |
46922450 |
accttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactagaaaccatcttca |
46922351 |
T |
 |
| Q |
107 |
agagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaat |
185 |
Q |
| |
|
||||||| ||||| || || ||| ||||||||| |||||||||||| |||| |||||||| ||||| || |||||||| |
|
|
| T |
46922350 |
agagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtaacttcaatatcagcaat |
46922272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University