View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_27 (Length: 381)
Name: NF11386_low_27
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 32686969 - 32686822
Alignment:
| Q |
1 |
cgcctcacgatacatatggttattggagcaactccgtttctctcaatcaatcagcatcaatgattccgtaagaagatgtttgagatgtaaactaaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686969 |
cgcctcacgatacatatggttattggagcaactccgtttctctcaatcaatcagcatcaatgattccgtaagaagatgtttgagatgtaaactaaggaaa |
32686870 |
T |
|
| Q |
101 |
tgacacagtttgactatgtgaactaaacaaggaaattcctggtgaagg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686869 |
tgacacagtttgactatgtgaactaaacaaggaaattcctggtgaagg |
32686822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 223 - 366
Target Start/End: Original strand, 50336423 - 50336569
Alignment:
| Q |
223 |
gtcgatgttaggaagatttttgcgtgacggaaaaccattggccaaaatgtgtacttttgtgtggtgagcagtgctcgttcgtttgattcttcttacc--- |
319 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336423 |
gtcgatggtaggaagatttttgcgtgacggaaaaccattggccaaaatgtgtacttttgtgtggtgagcagtgctcgttcgtttgattcttcttaccaat |
50336522 |
T |
|
| Q |
320 |
aataataatactcatctcactctcatgtttgttgcttccttcttttt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336523 |
aataataatactcatctcactctcatgtttgttgcttccttcttttt |
50336569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University