View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_38 (Length: 316)
Name: NF11386_low_38
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 30 - 153
Target Start/End: Original strand, 52477243 - 52477366
Alignment:
| Q |
30 |
attgtagcaccaattggaactattggaccgattgtgagaagctaggtttggaagtgacaagaatctgaatcgagtgtgtacgctaggttgggagtgtgag |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52477243 |
attgtagcaccgattggaactattggaccgattgtgagaagctaggtttggaagtgacaagaatatgaatcgagtgtgtaggctaggttgggagtgtgag |
52477342 |
T |
|
| Q |
130 |
agcgagagcgtgtgaagtcataac |
153 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
52477343 |
agcgagagcgtgtgaagccataac |
52477366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 247 - 298
Target Start/End: Original strand, 52477492 - 52477543
Alignment:
| Q |
247 |
ttgagattggtgagtgagtgagtttgagattttagggttttggaggtgttgg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477492 |
ttgagattggtgagtgagtgagtttgagattttagggttttggaggtgttgg |
52477543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 40067044 - 40066990
Alignment:
| Q |
30 |
attgtagcaccaattggaactattggaccgattgtgagaagctaggtttggaagt |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40067044 |
attgtagcaccgattggaactattggaccgattgtgagaagctaggtttggaagt |
40066990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 74 - 153
Target Start/End: Complemental strand, 1390732 - 1390651
Alignment:
| Q |
74 |
ggtttggaagtgacaagaatctgaatc--gagtgtgtacgctaggttgggagtgtgagagcgagagcgtgtgaagtcataac |
153 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||| | ||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
1390732 |
ggtttgggagtgagaagaatctgaatcaagagtgtgtaggttaggttgggagtgtgagagcgagtgtgtgtgaaggcataac |
1390651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University