View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_50 (Length: 256)
Name: NF11386_low_50
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 85 - 194
Target Start/End: Complemental strand, 42307754 - 42307645
Alignment:
| Q |
85 |
ggtcttcatgattctcacttttgttttgcaatttccatgtgttgggcagtgttggcaataatcattcgaattgccgtaatactattattccttttgttga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42307754 |
ggtcttcatgattctcacttttgttttgcaatttccatgtgttgggcagtgttggcaataatcattcgaattgccgtaatactattattccttttgttga |
42307655 |
T |
 |
| Q |
185 |
aaaaacgcgg |
194 |
Q |
| |
|
|||||||||| |
|
|
| T |
42307654 |
aaaaacgcgg |
42307645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 42307839 - 42307807
Alignment:
| Q |
1 |
ttaaaaaccctcttctcttcccatcaattgctc |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42307839 |
ttaaaaaccctcttctcttcccatcaattgctc |
42307807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University