View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_54 (Length: 249)
Name: NF11386_low_54
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 39771838 - 39771618
Alignment:
| Q |
19 |
ttatagtttccaaaataagag--gtttaggcaatttggtcattaatgatttctggaattaaaaaggtttatgatagtactagttattcaacacaatttca |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771838 |
ttatagtttccaaaataagagaggtttaggcaatttggtcgttaatgatttctgtaattaaaaaggtttatgatagtactagttattcaacacaatttca |
39771739 |
T |
 |
| Q |
117 |
taactaaattgaccaacccaaatggactaaatgatctaatatgatataagatttttaaaccctaaggtttggccttgtggcgtaggcttgcggcctagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771738 |
taactaaattgaccaacccaaatggactaaatgatctaatatgatataagatttttaaaccctaaggtttggccttgtggcgtaggcttgcggcctagaa |
39771639 |
T |
 |
| Q |
217 |
gtgtgctcctctctaggtctc |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39771638 |
gtgtgctcctctctaggtctc |
39771618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 237
Target Start/End: Original strand, 38463894 - 38463946
Alignment:
| Q |
185 |
ttggccttgtggcgtaggcttgcggcctagaagtgtgctcctctctaggtctc |
237 |
Q |
| |
|
||||||| |||||| ||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
38463894 |
ttggcctggtggcgaaggcttgggacctaggagtgtgctcctctctaggtctc |
38463946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University