View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_56 (Length: 244)
Name: NF11386_low_56
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 353560 - 353785
Alignment:
| Q |
1 |
ctttcaacctatacattgctaattcatgggctctgcagagcagatagatgcaagtgggcattcaatctgttcgaggagatggttgatcaggatatcatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353560 |
ctttcaacctatacattgctaattcatgggctctgcagagcagatagatgcaagtgggcattcaatctgttcgaggagatggttgatcaggatatcatgc |
353659 |
T |
|
| Q |
101 |
ctagatacaaaacttgccgtttgctcttggattaagtcaaacagaaaaatatgtatcaagctgttgagaaaattgaatttcttatgaataaactttatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353660 |
ctagatacaaaacttgccgtttgctcttggattaagtcaaacagaaaaatatgtatcaagctgttgagaaaattgaatttcttatgaataaactttatat |
353759 |
T |
|
| Q |
201 |
gtatgtatgtttctaaatataataga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
353760 |
gtatgtatgtttctaaatataataga |
353785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 10580337 - 10580533
Alignment:
| Q |
1 |
ctttcaacctatacattgctaattcatgggctctgcagagcagatagatgcaagtgggcattcaatctgttcgaggagatggttgatcaggatatcatgc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
10580337 |
ctttcaacctattcattgctaattcatgggctttgcagagcagatagatgcaagtgggcattcgatctgttcgaggagatggttgatcaagatatcgtgc |
10580436 |
T |
|
| Q |
101 |
ctagatacaaaacttgccgtttgctcttggattaagtcaaacagaaaaatatgtatcaagctgttgagaaaattgaatttcttatgaataaacttta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
10580437 |
ctagatacaaaacttgccgtttgctcttggatgaagtcaaacagaaaaatatgtatcaagctgttgacaaaattgatgttcttatgaagaaacttta |
10580533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 24578744 - 24578945
Alignment:
| Q |
1 |
ctttcaacctatacattgctaattcatgggctctgcagagcagatagatgcaagtgggcattcaatctgttcgaggagatggttgatcaggatatcatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| ||| |
|
|
| T |
24578744 |
ctttcaacctatacattgctaattcatgggctttacagagcagatagatgcaagtgggcattcgatctgttcgaggagatggctgatcaagatatcgtgc |
24578843 |
T |
|
| Q |
101 |
ctagatacaaaacttgccgtttgctcttggattaagtcaaacagaaaaatatgtatcaagctgttgagaaaattgaatttcttatgaataaactttatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||| ||||||||| |||||||||| |||||||| || |
|
|
| T |
24578844 |
ctagatacaaaacttgccgtttgctcttggatgaagtcaaacagaaaaatatgcatctcgctgttgtgaaaattgaggttcttatgaagaaactttaaat |
24578943 |
T |
|
| Q |
201 |
gt |
202 |
Q |
| |
|
|| |
|
|
| T |
24578944 |
gt |
24578945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University