View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_64 (Length: 240)
Name: NF11386_low_64
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_64 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 1572951 - 1573173
Alignment:
| Q |
18 |
tgcaaaatcttgctcatccggccaacttatctgacccccttctccttgattggattaaatatgcaaataacccaatcttggagcccccacctgacattgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
1572951 |
tgcaaaatcttgctcatccggccaacttatctgacccccttctccttgattgggttaaatatgcaaataacccaatcttagagcccccacctggcattgg |
1573050 |
T |
 |
| Q |
118 |
ttcaaaggatttccgcgatccaaccaccggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaaggacaaacaggtctttcattg |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573051 |
ttcaaaggatttccgcgatccaaccactggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaaggacaaacaggtctttcattg |
1573150 |
T |
 |
| Q |
218 |
gtttacaaaaccacaaattttat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1573151 |
gtttacaaaaccacaaattttat |
1573173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University