View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_67 (Length: 237)
Name: NF11386_low_67
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 18325710 - 18325567
Alignment:
| Q |
77 |
aaaaacacaaaattacagcttactagttgtgataacttttacaaagagaaaacttcaatggtacgtatgtaccaagaaaagagaacacttcctcaagggg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18325710 |
aaaaacacaaaattacagcttactagttgtgataacttttacaaagtgaaaacttcaatggtacgtatgtaccaagaaaagagaacacttcctcaaggga |
18325611 |
T |
|
| Q |
177 |
gaaagtgtttggaaatgataatcaacaatattcacattggtatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18325610 |
gaaagtgtttggaaatgataatcaacaatattcacattggtatt |
18325567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 27749612 - 27749664
Alignment:
| Q |
29 |
aattcaaaacgagatacaaaagttgtataaatttcaatgataaggtttaaaaa |
81 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
27749612 |
aattcaaaacaagatataagagttgtataaattgcaaagataaggtttaaaaa |
27749664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University