View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386_low_70 (Length: 234)
Name: NF11386_low_70
Description: NF11386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 2431177 - 2431374
Alignment:
| Q |
18 |
agaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaagcatatatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431177 |
agaggctgaaaatccgagtggtaaaataaatcttctgaacaaaaaagtgaaaaacagtcatccatattggtagacataactatatgcaaagcatatatgt |
2431276 |
T |
 |
| Q |
118 |
ataggttggcaactgtccttttccattggctcagttcacagttatttggaagtgaatgttacataaatcgaggtggcagccgttagaagaatactatc |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431277 |
ataggttggcgactgtccttttccattggctcagttcacagttatttggaagtgaatgtcacataaatcgaggtggcagccgttagaagaatactatc |
2431374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University