View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11387_low_10 (Length: 238)
Name: NF11387_low_10
Description: NF11387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11387_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 45 - 230
Target Start/End: Original strand, 10313562 - 10313747
Alignment:
| Q |
45 |
cccaattcagtgcccatagcaaacccgaagctattgtgatatgtacttcacaacttggtgcaaaccattcagtgttggccaaaacaaaaacacctcagtc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313562 |
cccaattcagtgcccatagcaaacccgaagctactgtgatatgtacttcacaacttggtgaaaaccattcagtgttggccaaaacaaaaacacctcagtc |
10313661 |
T |
 |
| Q |
145 |
atctcggctatacacacccaacttaatgtggaatactcaaaggagttgaaacggcgcatggcaatatacagacattggatgtgatg |
230 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||| | |||||||| ||||||||||||||| |
|
|
| T |
10313662 |
atctcggctatacacacctagcttaatgtggaatactcaaaggagttgaaatggcgcattgtaatatacacacattggatgtgatg |
10313747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 10313490 - 10313532
Alignment:
| Q |
1 |
caatgaattccacaacatcactctatgaagaggctgtgctatc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313490 |
caatgaattccacaacatcactctatgaagaggctgtgctatc |
10313532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University