View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11387_low_11 (Length: 232)
Name: NF11387_low_11
Description: NF11387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11387_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 6668062 - 6668175
Alignment:
| Q |
18 |
attgaaaaacgaaacgaatatgtggtggttgatatttagatcatcacaagggagagagatccgtagcggatagcggtgtcggtattggaagctactaatc |
117 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6668062 |
attgaaaaacgaaacgaatatatggtgattgatatttagatcatcacaggggagagagatccgtagcggagagcggtgtcggtattggaagctactaatc |
6668161 |
T |
 |
| Q |
118 |
tttggtgattgaga |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6668162 |
tttggtgattgaga |
6668175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University