View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11387_low_11 (Length: 232)

Name: NF11387_low_11
Description: NF11387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11387_low_11
NF11387_low_11
[»] chr2 (1 HSPs)
chr2 (18-131)||(6668062-6668175)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 6668062 - 6668175
Alignment:
18 attgaaaaacgaaacgaatatgtggtggttgatatttagatcatcacaagggagagagatccgtagcggatagcggtgtcggtattggaagctactaatc 117  Q
    ||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||    
6668062 attgaaaaacgaaacgaatatatggtgattgatatttagatcatcacaggggagagagatccgtagcggagagcggtgtcggtattggaagctactaatc 6668161  T
118 tttggtgattgaga 131  Q
    ||||||||||||||    
6668162 tttggtgattgaga 6668175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University