View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11387_low_7 (Length: 289)
Name: NF11387_low_7
Description: NF11387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11387_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 51212792 - 51212518
Alignment:
| Q |
1 |
catgtgagggcttcagtataaagtatgcaaatacacattaaacttactcgagcaaggtctccaagtaaggcaaatgcactttggcgaacatcgtgagcat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212792 |
catgggagggcttcagtataaagtatgcaaatacaaattaaacttactcgagcaaggtctccaagtaaggcaaatgcactttggcgaacatcgtgagcat |
51212693 |
T |
 |
| Q |
101 |
catcagtacaacattgcaaaagtaggtccctcaaagaacattgtgaaacctgcagagtagtagtaattgagataacctcaagaaatcatacgatcactgg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212692 |
catcagtacaacattgcaacagtaggtccctcaaagaacattgtgaaacctgcagagtagtagtaattgagataacctcaagaaatcatacgatcactgg |
51212593 |
T |
 |
| Q |
201 |
tttaaatatcctcaagcagatatcaatacgttaaacagcataggaaagttcaggaaatgcagattagatgtccat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212592 |
tttaaatatcctcaagcagatatcaatacattaaacagcataggaaagttcaggaaatgcagattagatgtccat |
51212518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University