View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_high_16 (Length: 390)
Name: NF11389_high_16
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 30 - 372
Target Start/End: Original strand, 21830609 - 21830951
Alignment:
| Q |
30 |
tgaattatctttaacagaatttgaccaaagatgagtttcttgattgttgtttttgttctcgaattttttcgtgatggcgcggctaataacaatgctagtg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830609 |
tgaattatctttaacagaatttgaccaaagatgagtttcttgattgttgtttttgttctcgaattttttcgtgatggcgcggctaataacaatgctagta |
21830708 |
T |
|
| Q |
130 |
gctttaagattctctttattttcatctaatcccatacttccaagcaatcttcgtcttctttccgtgatggatcccggagcagccatccatatatcatagt |
229 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21830709 |
gctttaagattctctttattttcatccaatcccatacttccaagcaatcttcgtcttctttctgtgatagatcccggagcagccatccatatatcatagt |
21830808 |
T |
|
| Q |
230 |
taggagcaatgccggtagccgggggaagctccggcttccggtgtttggcagggtgaaatgaggagactgcagaggcaaaggataaccggctattttcata |
329 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21830809 |
ttggagcaatgccggtagccgggggaagctccggcttccggtgtttggaagggtgaaaggaggagactgcagaggcaaaggataaccggctatcttcata |
21830908 |
T |
|
| Q |
330 |
atcatcatcttcatcagaagaagaagctaagtcatcggggacg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830909 |
atcatcatcttcatcagaagaagaagctaagtcatcggggacg |
21830951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University