View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_high_26 (Length: 273)
Name: NF11389_high_26
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 257
Target Start/End: Complemental strand, 21700520 - 21700278
Alignment:
| Q |
15 |
ggcacaggtgaatctattccaattcttaacgaaccatggctgcaaggtggtaagtgtattgatggtaatttgcatgaaaactattttttacataactaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
21700520 |
ggcacaggtgaatctattccaattcttaacgaaccatggctgcaaggtggtaagggtattgatggtaattttcctgaaaactattttttacataactaca |
21700421 |
T |
 |
| Q |
115 |
tagtgcgtcgtttaatggacacgggaaacaaacaatggaatacatatctaattcttcgtattttcaatgtcgatcagggtaaagatattctccaaactcc |
214 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21700420 |
tagtgcgtagtttaatggacacaggaaacaaacaatggaatacatatctaattcttcgtattttcaatgtcgatcaggctaaagatattctccaaactcc |
21700321 |
T |
 |
| Q |
215 |
attggttcctcaagtcccggaggacctcttagtttggaaagga |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
21700320 |
attggttcctcaagtcccggaggaccgcttaatttggaaagga |
21700278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University