View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11389_high_33 (Length: 235)

Name: NF11389_high_33
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11389_high_33
NF11389_high_33
[»] chr1 (1 HSPs)
chr1 (1-235)||(28607260-28607494)


Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28607260 - 28607494
Alignment:
1 tcaaggaccaatttaggggatcaatctaattgttcattagtgaaaggtgacaaattaaagctttgcgtagattatcccacataaactagtgtcaagggga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
28607260 tcaaggaccaatttaggggatcaatctaattgttcattagtgaagggtgacaaattaaagctttgcgtagattagcccacataaactagtgtcaagggga 28607359  T
101 ttcgaacctgtgactttgatttcttatgtcagtgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagaca 200  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28607360 ttcgaacctgtgactttgatttcttatgtcagcgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagaca 28607459  T
201 tctacatcaatcaacggaaccaattagatatggcc 235  Q
    ||||||||||||||| |||||||||||||||||||    
28607460 tctacatcaatcaactgaaccaattagatatggcc 28607494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University