View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_low_24 (Length: 338)
Name: NF11389_low_24
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 57 - 232
Target Start/End: Complemental strand, 13201968 - 13201799
Alignment:
| Q |
57 |
gatatatggatcaatacttagagtgtggtatactattttattgtttgcannnnnnnnnnnaaatgatggaatagaagagaaagtgacaaacatttattcc |
156 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
13201968 |
gatatatggatcaatactt-gagtgtggtatactattttattgtttggatttttttttt-aaatgatggaatagaagagaaaatgataa-catttattcc |
13201872 |
T |
 |
| Q |
157 |
atctcatttttattgtttctcttcctttcgatctaaattttgttctttatactactagtgccacacaattgaaagt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
13201871 |
atctcatttttattgtttctcttcctttctatctaaattttgttcttta---tacaagtggcacacaattgaaagt |
13201799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University