View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_low_36 (Length: 235)
Name: NF11389_low_36
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 217
Target Start/End: Original strand, 16897994 - 16898177
Alignment:
| Q |
34 |
ccccacccaacgcgtagccgaaatttttgggtccacctttggttttggaggaggaagaattgattatagaggtgcataaaggattttgacacctttgaat |
133 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16897994 |
ccccccccaacgcgtagcggaaatttttgggtccacctttggttttgaaggaggaagaattgattatagaggtgcataaaggattttgacacctttgaat |
16898093 |
T |
 |
| Q |
134 |
gctgtcaagcagaaattattttgtctccggagttgttttagcttgaagctagaatttggaacttttgtctctagaattaacttt |
217 |
Q |
| |
|
||| |||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16898094 |
gctctcaagcagaattgattttgtctccggagttgttttaacttgaagctagaatttggaacttttgtctctagaattaacttt |
16898177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University