View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11389_low_36 (Length: 235)

Name: NF11389_low_36
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11389_low_36
NF11389_low_36
[»] chr5 (1 HSPs)
chr5 (34-217)||(16897994-16898177)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 217
Target Start/End: Original strand, 16897994 - 16898177
Alignment:
34 ccccacccaacgcgtagccgaaatttttgggtccacctttggttttggaggaggaagaattgattatagaggtgcataaaggattttgacacctttgaat 133  Q
    |||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
16897994 ccccccccaacgcgtagcggaaatttttgggtccacctttggttttgaaggaggaagaattgattatagaggtgcataaaggattttgacacctttgaat 16898093  T
134 gctgtcaagcagaaattattttgtctccggagttgttttagcttgaagctagaatttggaacttttgtctctagaattaacttt 217  Q
    ||| |||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
16898094 gctctcaagcagaattgattttgtctccggagttgttttaacttgaagctagaatttggaacttttgtctctagaattaacttt 16898177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University