View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_low_37 (Length: 235)
Name: NF11389_low_37
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_low_37 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28607260 - 28607494
Alignment:
| Q |
1 |
tcaaggaccaatttaggggatcaatctaattgttcattagtgaaaggtgacaaattaaagctttgcgtagattatcccacataaactagtgtcaagggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28607260 |
tcaaggaccaatttaggggatcaatctaattgttcattagtgaagggtgacaaattaaagctttgcgtagattagcccacataaactagtgtcaagggga |
28607359 |
T |
|
| Q |
101 |
ttcgaacctgtgactttgatttcttatgtcagtgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28607360 |
ttcgaacctgtgactttgatttcttatgtcagcgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagaca |
28607459 |
T |
|
| Q |
201 |
tctacatcaatcaacggaaccaattagatatggcc |
235 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28607460 |
tctacatcaatcaactgaaccaattagatatggcc |
28607494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University