View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11389_low_41 (Length: 212)
Name: NF11389_low_41
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11389_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 10069640 - 10069527
Alignment:
| Q |
4 |
tcttcttcttctaatactcacatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069640 |
tcttcttcttctaatactcacatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactct |
10069541 |
T |
 |
| Q |
104 |
tcgtctctctgctt |
117 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10069540 |
tcgtctctctgctt |
10069527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University