View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11389_low_41 (Length: 212)

Name: NF11389_low_41
Description: NF11389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11389_low_41
NF11389_low_41
[»] chr8 (1 HSPs)
chr8 (4-117)||(10069527-10069640)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 10069640 - 10069527
Alignment:
4 tcttcttcttctaatactcacatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactct 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10069640 tcttcttcttctaatactcacatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactct 10069541  T
104 tcgtctctctgctt 117  Q
    ||||||||||||||    
10069540 tcgtctctctgctt 10069527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University