View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11390_high_16 (Length: 226)
Name: NF11390_high_16
Description: NF11390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11390_high_16 |
 |  |
|
| [»] scaffold0173 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0173 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: scaffold0173
Description:
Target: scaffold0173; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 63 - 201
Target Start/End: Complemental strand, 7214 - 7068
Alignment:
| Q |
63 |
tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtgatttctcactccttcgttgcgtgaaatagaatctctt---- |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
7214 |
tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtgatttctcactcctccgttgcgtgaaatagaatcgcttctac |
7115 |
T |
 |
| Q |
159 |
----gaaattagaattcgaatgaaccctcttcctatttttcaccacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7114 |
tatagaaattagaattcgaatgaaccctcttcttatttttcaccacc |
7068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0173; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 63 - 121
Target Start/End: Complemental strand, 21105 - 21047
Alignment:
| Q |
63 |
tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21105 |
tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtg |
21047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University