View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11390_high_20 (Length: 206)
Name: NF11390_high_20
Description: NF11390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11390_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 850592 - 850421
Alignment:
| Q |
15 |
atgaaacaaagcagtcatagaatcaaatttaataatctcaacatgcgaaaaaccacggcctttagcacttgcaacccaattataaatagcccaaagttca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
850592 |
atgaaacaaagcagtcatagaatcaaatttaataatctcaatatgcaaaaaaccacggcctttagcacttgcaacccaattataaataggccaaagttca |
850493 |
T |
|
| Q |
115 |
gccatagcgataatgcaacctggtaactataagagtagaatgatagaccaccaaatcatttttggatcgtca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
850492 |
gccatagcgataatgcaacctggtaactgtaggagtagaatgatagaccaccaaatcatttttggatcgtca |
850421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University