View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11390_low_16 (Length: 226)

Name: NF11390_low_16
Description: NF11390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11390_low_16
NF11390_low_16
[»] scaffold0173 (2 HSPs)
scaffold0173 (63-201)||(7068-7214)
scaffold0173 (63-121)||(21047-21105)


Alignment Details
Target: scaffold0173 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: scaffold0173
Description:

Target: scaffold0173; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 63 - 201
Target Start/End: Complemental strand, 7214 - 7068
Alignment:
63 tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtgatttctcactccttcgttgcgtgaaatagaatctctt---- 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||        
7214 tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtgatttctcactcctccgttgcgtgaaatagaatcgcttctac 7115  T
159 ----gaaattagaattcgaatgaaccctcttcctatttttcaccacc 201  Q
        |||||||||||||||||||||||||||| ||||||||||||||    
7114 tatagaaattagaattcgaatgaaccctcttcttatttttcaccacc 7068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0173; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 63 - 121
Target Start/End: Complemental strand, 21105 - 21047
Alignment:
63 tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtg 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21105 tttacctaacggagttgaagggttttggagtgttttcgtttgcgttggtggagattgtg 21047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University