View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11390_low_18 (Length: 215)
Name: NF11390_low_18
Description: NF11390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11390_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 5 - 195
Target Start/End: Complemental strand, 7626730 - 7626540
Alignment:
| Q |
5 |
tgaggaggagcacagatacatggcatgggaatgtctcacacttaccagaccaattccctaatttcacctgctccaattaacttgtgatagaacccacgta |
104 |
Q |
| |
|
|||||| || |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7626730 |
tgaggaagaacacacacacatggcatgggaatgtctcacacttaccagaccaattccctaatttcacctgctccaattaacttgtgatagaacccacgta |
7626631 |
T |
|
| Q |
105 |
cactaacactattgttttaaggtttagtacactgaataatgtacaagatcgatcattccaaacacattacatgtgtgtgacaaatgttaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7626630 |
cactaacactattgttttaaggtttagtacactgaataatgtacaagatcgatcattccaaacacattacatgtgtgtgacaaatgttaag |
7626540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University