View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11390_low_20 (Length: 206)

Name: NF11390_low_20
Description: NF11390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11390_low_20
NF11390_low_20
[»] chr5 (1 HSPs)
chr5 (15-186)||(850421-850592)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 850592 - 850421
Alignment:
15 atgaaacaaagcagtcatagaatcaaatttaataatctcaacatgcgaaaaaccacggcctttagcacttgcaacccaattataaatagcccaaagttca 114  Q
    ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
850592 atgaaacaaagcagtcatagaatcaaatttaataatctcaatatgcaaaaaaccacggcctttagcacttgcaacccaattataaataggccaaagttca 850493  T
115 gccatagcgataatgcaacctggtaactataagagtagaatgatagaccaccaaatcatttttggatcgtca 186  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||    
850492 gccatagcgataatgcaacctggtaactgtaggagtagaatgatagaccaccaaatcatttttggatcgtca 850421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University