View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_high_29 (Length: 299)
Name: NF11391_high_29
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 41264418 - 41264129
Alignment:
| Q |
1 |
tgtgtcagtgtcatgtctgatgttcatgtttgtatccgtatttcatagcttgtggccttattaattatatgtattaaaatttgacatagtcaactatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41264418 |
tgtgtcagtgtcatgtctgatgttcatgtttgtatcggtatttcatagcttgtggccttatta----tatgtattaaaatttgacatagtcaactatatt |
41264323 |
T |
 |
| Q |
101 |
ttaatgttgatgaactatggttgcaaaattttacactgccaagtgtcaactaatcacaaatcttgaatgtgacttgcaagatagttaagattatattcaa |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
41264322 |
ttaatgttgatgaactatgggtgcaaaattttacactgccaagtgtcaactaatcacaaatcttgtatgtgacttgcaagatagttaatattatattcaa |
41264223 |
T |
 |
| Q |
201 |
acattagatcctatgttatgtgcagcttgagggatgctgatcatttcttgtgaataatattatccagatgtttcaactgatggtctgtgctgct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
41264222 |
acattagatcctatgttatgtgcagcttgagggatgctgatcatttcttgtgaataatattatccagatgtttcaactgatggtgtgtggtgct |
41264129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University