View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_high_38 (Length: 232)
Name: NF11391_high_38
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_high_38 |
 |  |
|
| [»] chr6 (63 HSPs) |
 |  |
|
| [»] chr7 (84 HSPs) |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |
|
| [»] chr4 (90 HSPs) |
 |  |
|
| [»] chr8 (74 HSPs) |
 |  |
|
| [»] chr5 (75 HSPs) |
 |  |
|
| [»] chr3 (81 HSPs) |
 |  |
|
| [»] chr2 (83 HSPs) |
 |  |
|
| [»] chr1 (93 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 63)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 19276205 - 19275991
Alignment:
| Q |
18 |
atgtaccacaatatgattatgccattgtaaagtttgaattatggtcttctgcactctacattaccggttctataagtagcttcataatctattcggtaat |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19276205 |
atgtaccacaatatgatcatgccattgtaaagtttgaattatggtcttctgcactctacattaccggttctataagtagcttcataatctattaggtaat |
19276106 |
T |
 |
| Q |
118 |
gtttggttaaataaagtaattgactgcttttagcacgtgtttataagtattttcatatatataccatgctaaaatatagttttagtccctacaaatatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| | |
|
|
| T |
19276105 |
gtttggttaaataaagtaattgactgcttttagcacgtgtttataagtattttcatatatatactaggttaaaatatagttttagtccctacaaatatac |
19276006 |
T |
 |
| Q |
218 |
ctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19276005 |
ctcattttggtttta |
19275991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7155798 - 7155845
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7155845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 5286949 - 5286903
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
5286903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 229
Target Start/End: Original strand, 27764912 - 27764958
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtt |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
27764912 |
atgctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 317813 - 317860
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
317860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 494406 - 494453
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
494453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 7156159 - 7156112
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7156112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15076203 - 15076156
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15076156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15962388 - 15962341
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19296406 - 19296359
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 21385583 - 21385536
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
21385583 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
21385536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24274130 - 24274083
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24274083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 31166871 - 31166918
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
31166918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33801742 - 33801695
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33801695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34582530 - 34582577
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
34582577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 3356495 - 3356450
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3356450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 20467354 - 20467399
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
20467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 26376042 - 26375997
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26375997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 543365 - 543409
Alignment:
| Q |
188 |
aaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 232
Target Start/End: Original strand, 23770161 - 23770209
Alignment:
| Q |
184 |
tgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
23770161 |
tgctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23770209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 31276105 - 31276149
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||| ||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggtttt |
31276149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1007508 - 1007461
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1007461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1890451 - 1890404
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
1890404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 2615873 - 2615920
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
2615920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3356143 - 3356190
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3356190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3414388 - 3414435
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3414435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3969008 - 3968961
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3968961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8680776 - 8680823
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggtttta |
8680823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 8681115 - 8681068
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
8681068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 12299139 - 12299092
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
12299092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12419709 - 12419756
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
12419709 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 12419937 - 12419890
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14428651 - 14428698
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
14428698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14655380 - 14655427
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
14655427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 15962028 - 15962075
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
15962075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 17771912 - 17771959
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
17771959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19321130 - 19321083
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19321083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 20467717 - 20467670
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20467670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 21994402 - 21994355
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
21994355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 21995065 - 21995112
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggtttta |
21995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22543355 - 22543402
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
22543355 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22543402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22792898 - 22792851
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
22792851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22822650 - 22822603
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
22822603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 23502539 - 23502492
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24273829 - 24273876
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
24273876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25137356 - 25137309
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
25137356 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25137309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25431853 - 25431806
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25431806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 30928682 - 30928729
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30928729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 30929043 - 30928996
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30928996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31398540 - 31398493
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31398540 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
31398493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32885674 - 32885721
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
32885674 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
32885721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 34582891 - 34582844
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
34582844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 2616239 - 2616193
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
2616239 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 6591116 - 6591162
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
6591116 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 23502238 - 23502284
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
23502238 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 7324189 - 7324144
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
7324144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 12176640 - 12176595
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 34990312 - 34990267
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
34990267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 2373180 - 2373224
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtt |
229 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtt |
2373224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 229
Target Start/End: Complemental strand, 11449168 - 11449124
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtt |
229 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| |||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtt |
11449124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |
|
|
| T |
23770438 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 84)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 39719354 - 39719401
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719354 |
gctaaaatatggttttagtccctacaaatatgcctcattttggtttta |
39719401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 6509469 - 6509422
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
6509422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45021855 - 45021808
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
45021808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45073640 - 45073593
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45073593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1006836 - 1006883
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1006883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1559344 - 1559391
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
1559344 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6108335 - 6108382
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6108382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7431952 - 7431999
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7431999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 8555798 - 8555751
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 12894401 - 12894354
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
12894354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 17999720 - 17999673
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
17999673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18927090 - 18927043
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
18927090 |
gctaaaatatagttttagtccctgcaaatatgtctcattttagtttta |
18927043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19561155 - 19561202
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19561202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19757749 - 19757796
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19757796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19783816 - 19783863
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
19783863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28262714 - 28262761
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
28262714 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28262761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28911905 - 28911858
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28911858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 30352903 - 30352856
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
30352903 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
30352856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35665878 - 35665925
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggtttta |
35665925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 37372903 - 37372856
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37372856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 41054235 - 41054188
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
41054188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 44402961 - 44403008
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggtttta |
44403008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 44508721 - 44508768
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44508768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 44509053 - 44509006
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44509006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 17854151 - 17854197
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
17854197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 17999466 - 17999512
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 14738603 - 14738648
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggtttta |
14738648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 16941049 - 16941004
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16941004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 30709328 - 30709373
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggtttta |
30709373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1007228 - 1007181
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
1007228 |
gctaaaatatggttttagtccctccaaatatgcctcgttttgatttta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1614903 - 1614856
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1614856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2945844 - 2945797
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2945844 |
gctaaaatatgtttttggtccctacaaatatgcctcgttttggtttta |
2945797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3975550 - 3975597
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3975837 - 3975790
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5234203 - 5234156
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6079810 - 6079857
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
6079857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6509209 - 6509256
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgtttta |
6509256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 8144657 - 8144610
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8144610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9659688 - 9659641
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9659641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10358367 - 10358320
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
10358320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 11767274 - 11767227
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggtttta |
11767227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 13769775 - 13769822
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13769822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13770080 - 13770033
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
13770033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14543711 - 14543758
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14543758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16853588 - 16853541
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16853541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18022703 - 18022656
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18022703 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
18022656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19561449 - 19561402
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19561402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 20388275 - 20388322
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
20388275 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
20388322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 21223747 - 21223700
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
21223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22539931 - 22539978
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
22539931 |
gctaaaatatggttttgatccctccaaatatgcctcattttggtttta |
22539978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 23399613 - 23399660
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 23676451 - 23676404
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
23676451 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23676404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 23816671 - 23816718
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
23816718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25092547 - 25092500
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
25092547 |
gctaaaatatggttttggtccctgcaaatatgcctctttttggtttta |
25092500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25988748 - 25988701
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25988701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 26878070 - 26878023
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
26878070 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
26878023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28911578 - 28911625
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
28911625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29198661 - 29198614
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29198614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 230
Target Start/End: Original strand, 30352563 - 30352606
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 31732102 - 31732149
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35015219 - 35015172
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
35015219 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35015172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35210514 - 35210467
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
35210467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 39832907 - 39832954
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39832954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 39833235 - 39833188
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
39833188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 41053843 - 41053890
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
41053843 |
gctaaaatatggttttggtccctgcaaatatgcctcattttgatttta |
41053890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 44344788 - 44344741
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
44344741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45073315 - 45073362
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45228917 - 45228870
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45228870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 46304383 - 46304336
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
46304383 |
gctaaaatatagttttagtccctgcaaatatgtttcgttttggtttta |
46304336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 46648714 - 46648667
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 48192487 - 48192440
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 48359074 - 48359027
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48359027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 6589022 - 6589068
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
6589022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 32189388 - 32189342
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
32189342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 227
Target Start/End: Original strand, 45021495 - 45021537
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttgg |
227 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
45021495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 232
Target Start/End: Complemental strand, 19758044 - 19758011
Alignment:
| Q |
199 |
ttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggtttta |
19758011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 25547256 - 25547301
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
25547301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||| |
|
|
| T |
31310678 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 43300611 - 43300660
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||| ||| ||||||||||| |
|
|
| T |
43300611 |
atgctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
43300660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 48192260 - 48192305
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Complemental strand, 1559704 - 1559664
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |
|
|
| T |
1559704 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 37372441 - 37372485
Alignment:
| Q |
188 |
aaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
37372485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 94331 - 94282
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
94331 |
atgctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 94058 - 94105
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 90)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 51763203 - 51763154
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
51763203 |
atgctaaaatatagttttggtccctgcaaatatgcctcattttggtttta |
51763154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 123535 - 123582
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
123582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 2180221 - 2180268
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
2180268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 27008085 - 27008132
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
27008132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45593229 - 45593276
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
45593229 |
gctaaaatatagttttagtccctacaaatatgcctcgttttggcttta |
45593276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 46292650 - 46292603
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
46292603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 50714241 - 50714288
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50714288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 51709026 - 51708979
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
51708979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 123893 - 123850
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggtttta |
123850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 2322094 - 2322141
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
2322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8904887 - 8904934
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
8904887 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13064464 - 13064417
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13064417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15555637 - 15555590
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
15555590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16712690 - 16712643
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16712643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18205157 - 18205204
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18205204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22099544 - 22099591
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22099591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 23778965 - 23779012
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
23779012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28448835 - 28448882
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggtttta |
28448882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32208543 - 32208590
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32208590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32365095 - 32365142
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32365142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35415632 - 35415585
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35415585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35763648 - 35763695
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35763695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 41345854 - 41345901
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41345901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 41346217 - 41346170
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
41346170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45505893 - 45505846
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45505846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 52017506 - 52017553
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 52017869 - 52017822
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 53717173 - 53717126
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
53717126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 29380669 - 29380715
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 29463912 - 29463866
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 11285502 - 11285551
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11285502 |
atgctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
11285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 14791502 - 14791547
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
14791547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 15555506 - 15555551
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15555551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 38054549 - 38054594
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38054594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 41619902 - 41619947
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41619947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 51545966 - 51545921
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51545921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2034854 - 2034807
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggtttta |
2034807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2180571 - 2180524
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | | ||||||||||| |
|
|
| T |
2180571 |
gctaaaatatagttttagtccctgcaaatatggcacgttttggtttta |
2180524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5052583 - 5052536
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||| ||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5052536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5827656 - 5827703
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
5827703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6827547 - 6827594
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6827594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 6827873 - 6827826
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
6827826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8760605 - 8760652
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
| T |
8760605 |
gctaaaatatagttttactccctgcaaatatgtctcgttttggtttta |
8760652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 9289267 - 9289314
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
9289267 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9289314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 13064160 - 13064207
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
13064207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13479610 - 13479563
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13530712 - 13530665
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
13530665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 14488186 - 14488139
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14488139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22099911 - 22099864
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22099864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 23245232 - 23245279
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 23779224 - 23779177
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
23779224 |
gctaaaatatggttttaatccctgcaaatatgtctcattttggtttta |
23779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24474962 - 24474915
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
24474915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24774046 - 24774093
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24774093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28809179 - 28809132
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
28809132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29380909 - 29380862
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29380862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29499183 - 29499230
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 30046791 - 30046744
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30046744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 30061132 - 30061085
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30061085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31560694 - 31560647
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
31560647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 32365482 - 32365435
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
32365435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34361804 - 34361851
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34361851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35464381 - 35464334
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 36054149 - 36054102
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
36054149 |
gctaaaatacggttttggtccctgcaaatatgcctcattttggtttta |
36054102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 42848390 - 42848343
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
42848343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 43231388 - 43231341
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
43231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45505601 - 45505648
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
45505648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 46088059 - 46088012
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
46088012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 46115415 - 46115462
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 46128549 - 46128596
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46128596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 47136170 - 47136123
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
47136123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 47274229 - 47274182
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||| ||||||||||| |
|
|
| T |
47274229 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
47274182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 50714564 - 50714517
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
50714517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 51545630 - 51545677
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
51545677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 51708694 - 51708741
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
51708741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 51738138 - 51738185
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 55072390 - 55072437
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
55072437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 55482467 - 55482420
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggtttta |
55482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 4211562 - 4211608
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
4211562 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 9445951 - 9445997
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
9445997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 14487803 - 14487849
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 18205521 - 18205475
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18205475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 46292393 - 46292439
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
46292393 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 8191390 - 8191345
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
8191345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 216
Target Start/End: Original strand, 12791608 - 12791641
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatg |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
12791608 |
atgctaaaatatagttttagtccctgcaaatatg |
12791641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 29499543 - 29499498
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 41920771 - 41920816
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgatttta |
41920816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 54208477 - 54208509
Alignment:
| Q |
200 |
tagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggtttta |
54208509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 74)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 21125720 - 21125767
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31445462 - 31445415
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31445462 |
gctaaaatatagttttgatccctacaaatatgcctcattttggtttta |
31445415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1408352 - 1408305
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1408352 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
1408305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1525810 - 1525857
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1525857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4375693 - 4375740
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 4621353 - 4621306
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
4621306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10776498 - 10776451
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10776451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13232561 - 13232514
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
13232561 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
13232514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 14239079 - 14239032
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14239032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14488717 - 14488764
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggtttta |
14488764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14495070 - 14495117
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14495117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16789368 - 16789321
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16789321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19494412 - 19494365
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19494365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22917565 - 22917612
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22917612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 27341590 - 27341543
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
27341543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32418319 - 32418366
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32418366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 43477164 - 43477211
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43477211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 27117975 - 27117929
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27117975 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 35115638 - 35115592
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
35115638 |
gctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 1685117 - 1685162
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1685162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1526171 - 1526124
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
1526171 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
1526124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2728596 - 2728549
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2728549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3511907 - 3511954
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3511907 |
gctaaaatatggttttggtcccttcaaatatgcctcgttttggtttta |
3511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 4017299 - 4017252
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
4017252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 4710219 - 4710172
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4710172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6146517 - 6146564
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6146564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 6146948 - 6146901
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
6146901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7272421 - 7272468
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
7272468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 7272750 - 7272703
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggtttta |
7272703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 7326420 - 7326373
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
7326373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 8094840 - 8094793
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
8094793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10755527 - 10755480
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
10755527 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 11019856 - 11019809
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
11019856 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 11976374 - 11976421
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11976421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14238752 - 14238799
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14238799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16643662 - 16643709
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
16643709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16644043 - 16643996
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
16643996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16789076 - 16789123
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
16789123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 17073808 - 17073855
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17073855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 17574462 - 17574415
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17574415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18549202 - 18549249
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
18549202 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
18549249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19494120 - 19494167
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19494167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 20984509 - 20984462
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
20984462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24090487 - 24090440
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24090440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Original strand, 24814710 - 24814753
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggtttta |
24814753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24955009 - 24954962
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
24954962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 25131112 - 25131159
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25131159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25131446 - 25131399
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
25131399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28346395 - 28346442
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28346757 - 28346710
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
28346757 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29158355 - 29158402
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
29158355 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29158402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29488109 - 29488062
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
29488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 32726270 - 32726223
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
32726223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33526411 - 33526364
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
33526364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 33636323 - 33636370
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
33636370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34963301 - 34963348
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
34963348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35097691 - 35097644
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35097644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35345616 - 35345569
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 37536087 - 37536134
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
37536134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 38930663 - 38930616
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40066498 - 40066545
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
40066545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 40066819 - 40066772
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
40066772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40844157 - 40844204
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
40844204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 224
Target Start/End: Original strand, 42429759 - 42429798
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
42429759 |
gctaaaatatggttttggtccctacaaatatgcctcattt |
42429798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 42430119 - 42430072
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42430072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 7420303 - 7420337
Alignment:
| Q |
197 |
ttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggtttt |
7420337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 13232271 - 13232305
Alignment:
| Q |
197 |
ttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggtttt |
13232305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 14495391 - 14495342
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||| ||||||||||| |
|
|
| T |
14495391 |
atgctaaaatatggtnttagtccccgcaaatatgcctcgttttggtttta |
14495342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 13779532 - 13779484
Alignment:
| Q |
184 |
tgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||| | ||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
13779532 |
tgctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
13779484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 32195281 - 32195321
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
32195281 |
gctaaaatatggttttggtccctacaaatatgtctcatttt |
32195321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 229
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtt |
229 |
Q |
| |
|
|||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
40493156 |
gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 75)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26133184 - 26133231
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
26133231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34125308 - 34125355
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
34125355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 184 - 232
Target Start/End: Original strand, 29172523 - 29172571
Alignment:
| Q |
184 |
tgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29172523 |
tgctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 232
Target Start/End: Complemental strand, 30800862 - 30800802
Alignment:
| Q |
172 |
atatatataccatgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| | | |||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30800862 |
atatatattctaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 2217495 - 2217542
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2217853 - 2217806
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4203457 - 4203504
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4203457 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5614529 - 5614482
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5614482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5950177 - 5950224
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5950224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 6118498 - 6118451
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7075573 - 7075620
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7075620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 10743725 - 10743772
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10743772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16038378 - 16038425
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16038425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18046347 - 18046300
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18046300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18633600 - 18633647
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18633960 - 18633913
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24443381 - 24443428
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
24443381 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
24443428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25561998 - 25561951
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25779161 - 25779114
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggtttta |
25779114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28213374 - 28213421
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
28213374 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28213421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28550828 - 28550875
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28550875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28863511 - 28863558
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28863837 - 28863790
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29172885 - 29172838
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29692745 - 29692792
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29692792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29875724 - 29875677
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29875677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 30800495 - 30800542
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30800495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 34125631 - 34125584
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
34125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35167164 - 35167117
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35167117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 36578082 - 36578035
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
36578035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 40029496 - 40029449
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
40029449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 16616370 - 16616416
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
16616416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 28108159 - 28108114
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggtttta |
28108114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 26071287 - 26071339
Alignment:
| Q |
180 |
accatgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||| ||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
26071287 |
accaggctaaaatatagtttcggtccctgcaaatatgtctcattttggtttta |
26071339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 293829 - 293876
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
293876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1105147 - 1105100
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1105100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1286683 - 1286730
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||| ||||||||||| |
|
|
| T |
1286683 |
gctaaaatatggtgttggtccctacaaatatgcctcgttttggtttta |
1286730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 1381610 - 1381563
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1381563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2636992 - 2636945
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2636945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5917459 - 5917412
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5917412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 6912498 - 6912545
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
6912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9179919 - 9179872
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 10408929 - 10408976
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10408976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10409325 - 10409278
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10409278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 11799457 - 11799410
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggtttta |
11799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13990894 - 13990847
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
13990847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15635706 - 15635659
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
15635659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 17070862 - 17070815
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
17070862 |
gctaaaatatggttttagtccctacaaatatgtctcgttttcgtttta |
17070815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18258163 - 18258210
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
18258163 |
gctaaaatatggttttggtccctgcaaatatggctcattttggtttta |
18258210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19565830 - 19565783
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19565783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19685379 - 19685332
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19685332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 20660949 - 20660996
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20660996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 23382296 - 23382249
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
23382249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24443743 - 24443696
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24443743 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24443696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 25561706 - 25561753
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
25561753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 26133412 - 26133365
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26133365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29151850 - 29151803
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
29151850 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
29151803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29366948 - 29366901
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29366901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31037740 - 31037693
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33336025 - 33335978
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
33335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35166912 - 35166959
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
35166959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35928065 - 35928112
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35928112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 36577723 - 36577770
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36577770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 38170515 - 38170562
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38170562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 38786160 - 38786207
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
38786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 39379609 - 39379562
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
39379562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40167787 - 40167834
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggtttta |
40167834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40764416 - 40764463
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 3850300 - 3850346
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
3850300 |
gctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 16038738 - 16038692
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
16038692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 42207570 - 42207525
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggtttta |
42207525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 9532532 - 9532487
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9532487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 20985728 - 20985773
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20985773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 27916761 - 27916716
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggtttta |
27916716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 39379242 - 39379287
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
39379287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 81)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3830135 - 3830182
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
3830182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 45006247 - 45006201
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45006201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3151751 - 3151798
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3151798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3152110 - 3152063
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3152063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3830515 - 3830468
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3830468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4513264 - 4513311
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4513311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4950038 - 4950085
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4950085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8510215 - 8510262
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggtttta |
8510262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9603918 - 9603871
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9603918 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 10976979 - 10977026
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10977026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12673645 - 12673692
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggtttta |
12673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19844580 - 19844533
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
19844533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 20612897 - 20612850
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
20612850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 21159816 - 21159769
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
21159769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22156292 - 22156245
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22156245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25710869 - 25710822
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25710822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28427607 - 28427560
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28427560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 37506868 - 37506915
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37506915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 37507221 - 37507174
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37507174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 39437108 - 39437061
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
39437061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 50196656 - 50196609
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgtttta |
50196609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 51834609 - 51834656
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51834656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 14633547 - 14633593
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14633593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 43440785 - 43440739
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggtttta |
43440739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 50196301 - 50196347
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
50196347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 20907454 - 20907409
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggtttta |
20907409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3361817 - 3361770
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
3361770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4814541 - 4814588
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5345688 - 5345641
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
5345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7588319 - 7588366
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
7588319 |
gctaaaatatagttttggtccctgcaaatatgccttgttttggtttta |
7588366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9262154 - 9262107
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9262107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9863403 - 9863356
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
9863356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13584366 - 13584319
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
13584319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 15016389 - 15016436
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
15016436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15979700 - 15979653
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
15979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16123140 - 16123187
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
16123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 20611021 - 20611068
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
20611068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 20644506 - 20644553
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
20644506 |
gctaaaatatagttttggtccctgcaaatatgtctcattttgatttta |
20644553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22008527 - 22008574
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22008574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22008889 - 22008842
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22008842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22016045 - 22016092
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22016092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 25615976 - 25616023
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25616023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26799889 - 26799936
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
26799936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28452375 - 28452328
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
28452328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28552382 - 28552335
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 28942526 - 28942573
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
28942526 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
28942573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 28942904 - 28942857
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
28942857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29445955 - 29446002
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29446002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 29955661 - 29955618
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29955618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 30004816 - 30004773
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30004773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 30130159 - 30130206
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
30130159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30130206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 30130499 - 30130456
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30130499 |
aaatatggttttagtcactgcaaatatgcctcattttggtttta |
30130456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 30268506 - 30268553
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30268553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 31480137 - 31480184
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
31480184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34238599 - 34238646
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34238646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 39288574 - 39288621
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39288621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 39288897 - 39288850
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
39288850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 39436719 - 39436766
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39436766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 40370588 - 40370541
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40370541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 44802283 - 44802330
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggtttta |
44802330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45002022 - 45002069
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45002069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45320978 - 45320931
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
45320931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 46186770 - 46186723
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
46186723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 46751272 - 46751319
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
46751319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 49323783 - 49323830
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
49323830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 50261935 - 50261888
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
50261935 |
gctaaaatatcgttttagtccctgcaaatatgtttcattttggtttta |
50261888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 51500684 - 51500637
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51500637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 51550083 - 51550130
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
51550130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 51760117 - 51760070
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51760070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 51834941 - 51834894
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
51834894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 52342196 - 52342243
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
52342196 |
gctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 53701662 - 53701615
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
53701662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
53701615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 54608519 - 54608566
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
54608566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 2486581 - 2486627
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggtttta |
2486627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 29955300 - 29955346
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
29955346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 30004454 - 30004500
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
30004500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 8940522 - 8940477
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8940477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 12673978 - 12673933
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggtttta |
12673933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 20757403 - 20757448
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
20757448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 46186408 - 46186457
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
46186408 |
atgctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
46186457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 19844266 - 19844306
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
19844266 |
gctaaaatatggttttggtccctacaaatatgcctcgtttt |
19844306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 83)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 8046647 - 8046600
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
8046600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 38731830 - 38731877
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
38731877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 10374773 - 10374822
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10374773 |
atgctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10374822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 7814736 - 7814689
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7814736 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
7814689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12835326 - 12835373
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
12835373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16900205 - 16900158
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16900158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16993596 - 16993549
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16993549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19184150 - 19184103
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19184103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22881614 - 22881661
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22881661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24483890 - 24483843
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 26814228 - 26814181
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26814181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 27109074 - 27109121
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27109074 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
27109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 31225716 - 31225763
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
31225716 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
31225763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 33732863 - 33732910
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33732910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33733240 - 33733193
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 37271740 - 37271787
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37271787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 37272101 - 37272054
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37272054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 38980252 - 38980205
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38980205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40124967 - 40125014
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
40125014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 40301976 - 40302023
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
40302023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 43788859 - 43788906
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 41791020 - 41791066
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
41791066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 44985623 - 44985669
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44985669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 16968555 - 16968600
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggtttta |
16968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 27310877 - 27310922
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 42358702 - 42358747
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
42358747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 2481556 - 2481509
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3172021 - 3172068
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3172021 |
gctaaaatatgattttggtccctgcaaatatgcctcattttggtttta |
3172068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 3671187 - 3671144
Alignment:
| Q |
189 |
aaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3837934 - 3837981
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||| |||||| |
|
|
| T |
3837934 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttcgtttta |
3837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3838263 - 3838216
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
3838216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4423896 - 4423943
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4423943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5334752 - 5334799
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5335039 - 5334992
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5790559 - 5790606
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
5790606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 5790898 - 5790851
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
5790851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7814247 - 7814294
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggtttta |
7814294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8046330 - 8046377
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
8046377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 9195055 - 9195102
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9195102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9195205 - 9195158
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
9195205 |
gctaaaatatggttttagaccctgcaaatatgcctcgttttggtttta |
9195158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10375068 - 10375021
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10665293 - 10665246
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| || ||||||||||| |
|
|
| T |
10665293 |
gctaaaatatagttttagtctctgcaaatatgcatcgttttggtttta |
10665246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 10671940 - 10671893
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10671893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 11713486 - 11713533
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11713533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 11713844 - 11713797
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
11713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 11788415 - 11788368
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11788368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 14003741 - 14003694
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
14003694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15842822 - 15842775
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16522992 - 16523039
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16523324 - 16523277
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 16673412 - 16673459
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
16673459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 17541383 - 17541430
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
17541430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18113453 - 18113406
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
18113453 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
18113406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19183783 - 19183830
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19183830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 20131680 - 20131633
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20131633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 23989839 - 23989886
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
23989886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24358617 - 24358664
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 25705448 - 25705401
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25705401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26813867 - 26813914
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26813914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 27311068 - 27311021
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
27311021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29859871 - 29859824
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29865222 - 29865269
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29865269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31226076 - 31226029
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 31326251 - 31326204
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| |||||| |
|
|
| T |
31326251 |
gctaaaatatagttttagtccttgcaaatatgcctcgttttagtttta |
31326204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32476096 - 32476143
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
32476096 |
gctaaaatatggttttgatccctgcaaatatgcctcattttggtttta |
32476143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 34318082 - 34318035
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
34318082 |
gctaaaatatggttttggtccctacaaatatgcctcgttttgatttta |
34318035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 36622251 - 36622298
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36622298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 38639413 - 38639460
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
38639460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 40302338 - 40302291
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
40302338 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
40302291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 41694002 - 41693955
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
41693955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 43592047 - 43592094
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
43592094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 43597155 - 43597202
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
43597155 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
43597202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 44073806 - 44073759
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
44073759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 146328 - 146374
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
146374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 4042817 - 4042783
Alignment:
| Q |
197 |
ttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
4042817 |
ttttggtccctacaaatatgcctcattttggtttt |
4042783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 36622582 - 36622536
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
36622536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 231
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 15842464 - 15842509
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 17912808 - 17912763
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
17912763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 29859490 - 29859535
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 41791311 - 41791266
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 43710384 - 43710429
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggtttta |
43710429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 232
Target Start/End: Original strand, 30215410 - 30215470
Alignment:
| Q |
172 |
atatatataccatgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| | |||||||||| ||||| |||||| ||||||||| || ||||||||||| |
|
|
| T |
30215410 |
atatatataaaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
30215470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 93)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 990089 - 990136
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
990136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3679627 - 3679674
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
3679674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 7818783 - 7818830
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7818830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 50799131 - 50799178
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50799178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 990378 - 990331
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
990331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1810928 - 1810975
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1810975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3753214 - 3753261
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3753261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 7001896 - 7001849
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7001849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 11822005 - 11822052
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
11822052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 13770490 - 13770537
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
13770490 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13770537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16026937 - 16026890
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
16026937 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16026890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 16060884 - 16060837
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16060837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18302386 - 18302339
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18302339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 18473273 - 18473320
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 18473594 - 18473547
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 22919685 - 22919732
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22919685 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24649351 - 24649398
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24649398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26061957 - 26062004
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26062004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 29072498 - 29072545
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29072545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 32729048 - 32729001
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32729001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 33234547 - 33234594
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
33234594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 33379889 - 33379936
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33379936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35005743 - 35005696
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35005696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35307716 - 35307763
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35307763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 35308110 - 35308063
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35308063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 41358370 - 41358417
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41358417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 44641079 - 44641126
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45368491 - 45368538
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45368538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 7350426 - 7350471
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggtttta |
7350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3753571 - 3753524
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
3753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4323829 - 4323876
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
4323876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 6567495 - 6567448
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
6567448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12360604 - 12360651
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
12360604 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
12360651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12361012 - 12361059
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggtttta |
12361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 13260320 - 13260273
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13260273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14007490 - 14007537
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14007537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 17984334 - 17984381
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
17984334 |
gctaaaatatggtttgagtccctgcaaatatgcctcgttttggtttta |
17984381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 17984700 - 17984653
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
17984653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19622656 - 19622703
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19622703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 19623016 - 19622969
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
19622969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 21383427 - 21383380
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||||||| ||||| |
|
|
| T |
21383427 |
gctaaaatatagttttaatccttgcaaatatgcctcattttgatttta |
21383380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 21391097 - 21391144
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
21391144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 22953555 - 22953508
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22953508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 24507842 - 24507795
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 24653803 - 24653850
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24653850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26191360 - 26191407
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
26191407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 26191733 - 26191686
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26191686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 26442564 - 26442611
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26442611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 26442898 - 26442851
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
26442851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29072861 - 29072814
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggtttta |
29072814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 29688427 - 29688380
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
29688380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 31258340 - 31258387
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
31258387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 32454293 - 32454246
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggcttta |
32454246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 32626530 - 32626577
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
32626577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33045689 - 33045642
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
33045642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 35005445 - 35005492
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35005492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 37545629 - 37545676
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
37545676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 38151211 - 38151164
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38151164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 38164294 - 38164247
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38164247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 41358662 - 41358615
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
41358615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 41738797 - 41738844
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
41738797 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
41738844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 41881094 - 41881141
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggtttta |
41881141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 42482980 - 42483027
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42483027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 44157696 - 44157743
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
44157743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 44641431 - 44641384
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
44641384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 45290458 - 45290505
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
45290505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 45290819 - 45290772
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
45290772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 47819233 - 47819280
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 47819595 - 47819548
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 48609593 - 48609546
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48609546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 48955715 - 48955762
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
48955762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 48956065 - 48956018
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
48956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 50429208 - 50429161
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
50429161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 52254184 - 52254231
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
52254231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 52254478 - 52254431
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
52254431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 22953258 - 22953304
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||| |||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggattta |
22953304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 231
Target Start/End: Original strand, 37624747 - 37624793
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
37624747 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 3247559 - 3247514
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3247514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 231
Target Start/End: Original strand, 15058496 - 15058525
Alignment:
| Q |
202 |
gtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15058496 |
gtccctacaaatatgcctcattttggtttt |
15058525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 15335292 - 15335247
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
15335247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 226
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
18079659 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 18899842 - 18899887
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18899887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 18900130 - 18900085
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggtttta |
18900085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 26062255 - 26062210
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggtttta |
26062210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 226
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 31258699 - 31258654
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgtttta |
31258654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 34808200 - 34808245
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggtttta |
34808245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 38163934 - 38163979
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 39303673 - 39303722
Alignment:
| Q |
183 |
atgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||| ||| ||||||||||| |
|
|
| T |
39303673 |
atgctaaaatatggttttagtccctgcaagtatgtctcgttttggtttta |
39303722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 232
Target Start/End: Original strand, 15058418 - 15058466
Alignment:
| Q |
184 |
tgctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||| ||| ||||||||||| |
|
|
| T |
15058418 |
tgctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
15058466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 232
Target Start/End: Complemental strand, 24649656 - 24649612
Alignment:
| Q |
188 |
aaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
24649612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 33380256 - 33380208
Alignment:
| Q |
185 |
gctaaaatatagttttagtccc-tacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
33380256 |
gctaaaatatggttttagccccctacaaatatgcctcgttttggtttta |
33380208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 46184051 - 46184007
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggtttt |
46184007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 2779 - 2826
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5210 - 5257
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5230 - 5277
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9027 - 8980
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 232
Target Start/End: Original strand, 8734 - 8780
Alignment:
| Q |
186 |
ctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 14698 - 14745
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 15011 - 14964
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
14964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 189677 - 189630
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
189677 |
gctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 366272 - 366225
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
366225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 232
Target Start/End: Original strand, 4016 - 4057
Alignment:
| Q |
191 |
atatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggtttta |
4057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 4311 - 4266
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 48228 - 48183
Alignment:
| Q |
187 |
taaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
48183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 1312 - 1359
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
1359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 8548 - 8595
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
8595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 288 - 241
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3454 - 3407
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||| ||||||||||| |
|
|
| T |
3454 |
gctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
3407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12526 - 12573
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 4042 - 4089
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 19224 - 19271
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 34932 - 34979
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
34979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 3533 - 3580
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 3917 - 3870
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
3917 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 54816 - 54863
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
54863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 5400 - 5447
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
5400 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
5447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 82705 - 82658
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
82658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 75763 - 75716
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
75716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 12183 - 12230
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
12230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 12535 - 12488
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
12488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Original strand, 10169 - 10216
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggtttta |
232 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
10216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 230
Target Start/End: Complemental strand, 17965 - 17920
Alignment:
| Q |
185 |
gctaaaatatagttttagtccctacaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
17920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University