View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_high_39 (Length: 224)
Name: NF11391_high_39
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_high_39 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 30496090 - 30496311
Alignment:
| Q |
3 |
cttaaaaggaaaaggtgagtgcattcaagttgcaagaattttaagggaagtgttatacaataaaagtatccagctaatagcatcagtctagttcacatat |
102 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30496090 |
cttaaaaggaaaagatgagtgcattaaagttgcaagaattttaagggaagtgttatacaataaaagtatccagctaatagcaccagtctagttcacatat |
30496189 |
T |
 |
| Q |
103 |
tgttggaaagtttgttatggttactaaataatcggtgttaggaaattcatccaagagagctcacacgtatgtttgagctctctcttgaggatgcgtccga |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
30496190 |
tgttggaaagtatgttatggttactaaataatcggtgttaggaaattcatccgatagagctcacacatatgtttgagctctctcttgaggatgcgttcga |
30496289 |
T |
 |
| Q |
203 |
tctcttgtagaggatttccaaa |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30496290 |
tctcttgtagaggatttccaaa |
30496311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University