View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_high_42 (Length: 205)
Name: NF11391_high_42
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 46063942 - 46063766
Alignment:
| Q |
14 |
gatgaacataaaagcgtttgcactaagtatggggtttctggttaccctacaataaagtggtttcccaagggatcactaaatccaaaaaagtgagcacttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063942 |
gatgaacataaaagcgtttgcactaagtatggggtttctggttaccctacaataaagtggtttcccaagggatcactaaatccaaaaaagtgagcacttt |
46063843 |
T |
 |
| Q |
114 |
gtccattttctttcctttcaaacatctctttttaccatagaaaatttgagagattttcatgctctttacttgttggt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46063842 |
gtccattttctttcctttcaaacatctctttttaccatagaaaatttgagagatattcatgctctttacttgttggt |
46063766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University