View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_17 (Length: 402)
Name: NF11391_low_17
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 128 - 387
Target Start/End: Original strand, 34666694 - 34666955
Alignment:
| Q |
128 |
gtgaatggaattgatttcagaagaagccacctcaagggaattgatttcagaagaagcccgtgaatggagttgatttcaatcgcatacaaaaataacttat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34666694 |
gtgaatggaattgatttcagaagaagccacctcaagggaattgatttcagaagaagcccgttaatggagttgatttcaatcgcatacaaaaataacttat |
34666793 |
T |
|
| Q |
228 |
tattttgcatnnnnnnnnn--ttacttttcttctttctacttcttctcttatctccgagtcctttctctccatgtgccaggttattaatttcaattgtac |
325 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34666794 |
tattttgcataaaaaaaaaaattacttttcttctttctacttcttctcttatctccgagtcctttctctccatgtgctaggttattaatttcaattgtac |
34666893 |
T |
|
| Q |
326 |
gtgaatggaattcattgatccggaagtaaaatgatcagatttatttctatgatcgttggaat |
387 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34666894 |
gtgaatggaattcattgaaccggaagtaaaatgatcagatttgtttctatgatcgttggaat |
34666955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University