View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_27 (Length: 318)
Name: NF11391_low_27
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 12 - 318
Target Start/End: Original strand, 30797245 - 30797545
Alignment:
| Q |
12 |
ggcgtagtaaaggctttttggtgtctggatctgtgtgtgatgtctcatctcgagaacaaagggagaagctcattcaagaagttgcctcaatcttcaatgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30797245 |
ggcgtagtaaaggctttttggtgtctggatctgtgtgtgatgtctcatctcgagaacaaagggagaagctcattcaagaagttgcctcaatcttcaatgg |
30797344 |
T |
 |
| Q |
112 |
taaacttcacatttatgtaagtaatgctcgattaatttttgcacattgttagtaccggcattcaacattagaaaggtgtgtctgatgtctgacatgatac |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30797345 |
taaacttcacatttatgtaagtcatgctcgattaatttttgcacattgttagtaccggcattcaacattagaaaggtgtgtctgatgtctgacatgatac |
30797444 |
T |
 |
| Q |
212 |
acgcatgtagttgggttcaatcatttacattttcttgaattactactatcactatgtatatgtgtgtcagtgttgtgtctgatatcagtgtctatacaat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30797445 |
acgcatgtagttgggttcaatcatttacattttcttgaattact------actatgtatatgtgtgtcagtgttgtgtctgatatcagtgtctatacact |
30797538 |
T |
 |
| Q |
312 |
aggaaat |
318 |
Q |
| |
|
||||||| |
|
|
| T |
30797539 |
aggaaat |
30797545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University