View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11391_low_3 (Length: 697)

Name: NF11391_low_3
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11391_low_3
NF11391_low_3
[»] chr4 (1 HSPs)
chr4 (645-679)||(42413043-42413077)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 645 - 679
Target Start/End: Complemental strand, 42413077 - 42413043
Alignment:
645 actgaagtgtttttgttattatcgacataacttct 679  Q
    |||||||||||||||||||||||||||||||||||    
42413077 actgaagtgtttttgttattatcgacataacttct 42413043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University