View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_32 (Length: 281)
Name: NF11391_low_32
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 6486050 - 6486313
Alignment:
| Q |
7 |
tagggttcttgagagaaactttccaaacacggattttaccgtcttggtgaccagtgaagatcttttgaccggatattatgattgctttcaccagtccact |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486050 |
tagggttcttgagagagactttccaaacacggattttaccgtcttggtgaccagtgaagatcttttgaccggatattatgattgctttcaccagtccact |
6486149 |
T |
|
| Q |
107 |
gttggatttgaatccgcaatattcttgaagattcttccacacacgaatgttcttgctgtctgaaccggtgtataataagtcaccggaagcggctaaagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6486150 |
gttggatttgaatccgcaatattcttgaagattcttccacacacgaatgttcttgctgtctgagccggtgtataataagtcaccggatgcggctaaagaa |
6486249 |
T |
|
| Q |
207 |
taaatgtgaccctcttcgcgaaccagtgaaccgattagtgaattctgtggaggtgtgtcttcat |
270 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
6486250 |
taaatgtgaccctcttcgcggaccagtgaaccaattagtgaattctgtggaggcgtgtcttcat |
6486313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 25703316 - 25703404
Alignment:
| Q |
153 |
atgttcttgctgtctgaaccggtgtataataagtcaccggaagcggctaaagaataaatgtgaccctcttcgcgaaccagtgaaccgat |
241 |
Q |
| |
|
||||| ||||| || | |||||||||||| | |||||||||| ||||||| || || |||||||| ||||||||| | ||||| ||||| |
|
|
| T |
25703316 |
atgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcgagctagtgacccgat |
25703404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 6917655 - 6917703
Alignment:
| Q |
136 |
gattcttccacacacgaatgttcttgctgtctgaaccggtgtataataa |
184 |
Q |
| |
|
|||||||||| ||||||||||| || || || ||||||||||||||||| |
|
|
| T |
6917655 |
gattcttccaaacacgaatgtttttactatcagaaccggtgtataataa |
6917703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University