View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_38 (Length: 250)
Name: NF11391_low_38
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 27 - 241
Target Start/End: Complemental strand, 41264698 - 41264484
Alignment:
| Q |
27 |
ctatcacatcatattttatcctgaaacattattttattaaaatcatcattttccgtttgaattctatgatgagggtacgtggtggcgatgacgactctgt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264698 |
ctatcacatcatattttatcctgaaacattattttattaaaatcatcattttccgtttgaattctatgatgagggtacgtggtggcgatgacgactctgt |
41264599 |
T |
|
| Q |
127 |
acatattcagctaggaaacaaacccggtgaccctttcatcatcactgtcaattgtcccgacaagactggtctcgcttgcgatatctgcagatttattctt |
226 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41264598 |
acaaattcagctaggaaacaaacccggtgaccctttcatcatcactgtcaattgtcccgacaagaccggtctcgcttgcgatatctgcagatttattctt |
41264499 |
T |
|
| Q |
227 |
cactttggtctctgc |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41264498 |
cactttggtctctgc |
41264484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University