View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_46 (Length: 220)
Name: NF11391_low_46
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_46 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 39079427 - 39079646
Alignment:
| Q |
1 |
gaagggggtacagtacagtatgcattaacgagctttgttgcttgggtaggttttaattaatcagcaaagtaatttaatgcaagaccttctccttttgggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39079427 |
gaagggggtacagtacagtatgcattaacgagctttgttgcttgggtaggttttaattaatcagcaaagtaatttaatgcaagaccttctctttttgggc |
39079526 |
T |
 |
| Q |
101 |
tgattttaatgcataaccttagcatggtgattcgggctacttgcatatcgtgttcaataaagtatcatatcttttttacttgtggggtaaacgataactt |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39079527 |
taattttaatgcataaccttagcatggtgattcgggctacttgcatatcgtgttcaataaagtatcatatctttttaacttgtggggtaaacgataactt |
39079626 |
T |
 |
| Q |
201 |
tttagctttaaagtacatca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39079627 |
tttagctttaaagtacatca |
39079646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University