View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11391_low_49 (Length: 201)

Name: NF11391_low_49
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11391_low_49
NF11391_low_49
[»] chr1 (1 HSPs)
chr1 (12-183)||(40146939-40147110)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 40147110 - 40146939
Alignment:
12 agaagcagagaatcaagtttctcagaacacgagaaggaaagagcgtcaacgagtggggtccattattatcagcatgtgaagagtggaagaacattggtgg 111  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
40147110 agaagcagacaatcaagtttctcggaacacgagaaggaaagagcgtcaacgagtggggtccattattataagcatgtgaagagtggaagaacattggtgg 40147011  T
112 aagtgttgagagaggttgatgcagatatattgggattgcaagatgtgaaagctgaagaagaaaatggaatga 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40147010 aagtgttgagagaggttgatgcagatatattgggattgcaagatgtgaaagctgaagaagaaaatggaatga 40146939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University