View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11391_low_49 (Length: 201)
Name: NF11391_low_49
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11391_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 40147110 - 40146939
Alignment:
| Q |
12 |
agaagcagagaatcaagtttctcagaacacgagaaggaaagagcgtcaacgagtggggtccattattatcagcatgtgaagagtggaagaacattggtgg |
111 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40147110 |
agaagcagacaatcaagtttctcggaacacgagaaggaaagagcgtcaacgagtggggtccattattataagcatgtgaagagtggaagaacattggtgg |
40147011 |
T |
 |
| Q |
112 |
aagtgttgagagaggttgatgcagatatattgggattgcaagatgtgaaagctgaagaagaaaatggaatga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40147010 |
aagtgttgagagaggttgatgcagatatattgggattgcaagatgtgaaagctgaagaagaaaatggaatga |
40146939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University